WormMine: Gene WBGene00133842

• WormBase Gene ID: WBGene00133842
• Gene Name: CJA14638
• Sequence Name: CJA14638
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Mir domain superfamily; MIR motif; and MIR domain. Is an ortholog of C. elegans R12E2.13. In C. elegans, R12E2.13 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14638.1	CJA14638.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14638	CJA14638		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082218
• Remark: CJA14638, ATAACGGGCGGAAGTGCGTGGAAGGTCGCGGAGGGCATTCACATTAAGCACCAGCAAAAG, WBGene00133842
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term