WormMine: Gene WBGene00133438

• WormBase Gene ID: WBGene00133438
• Gene Name: Cjp-mks-5
• Sequence Name: CJA14234
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: RPGRIP1 family; RPGR-interacting protein 1, first C2 domain; C2 domain superfamily; and First C2 domain of RPGR-interacting protein 1. Is an ortholog of C. elegans mks-5. In C. elegans, mks-5 is involved in several processes, including non-motile cilium assembly; protein localization to cilium; and protein to membrane docking.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14234b.1	CJA14234b.1		[unknown]
Transcript:CJA14234a.1	CJA14234a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14234a	CJA14234a		[unknown]
CDS:CJA14234b	CJA14234b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084228
• Remark: CJA14234, CTCACTCTGATCAAAAAGAGTCCAGGAGACGAGGAAGAACTTGCTTATGGAGTTTTTTCT, WBGene00133438
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term