WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123839 Gene Name  Cjp-dhs-28
Sequence Name  ? CJA04635 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: SCP2 sterol-binding domain superfamily; short chain dehydrogenase; SCP-2 sterol transfer family; Short-chain dehydrogenase/reductase SDR; NAD(P)-binding domain superfamily; and SCP2 sterol-binding domain. Is an ortholog of C. elegans dhs-28. In C. elegans, dhs-28 is involved in several processes, including ascaroside biosynthetic process; dauer entry; and positive regulation of developmental process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04635.1 CJA04635.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04635 CJA04635   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-dhs-28, CTTCAATACTACAAGTCCAAGGGAAAGGTTATCTCCAACGCCACTGCTGATGATATCGCA, WBGene00123839   Expr1077137 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term