WormMine: Gene WBGene00123750

• WormBase Gene ID: WBGene00123750
• Gene Name: Cjp-pfas-1
• Sequence Name: CJA04547
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: PurM-like, N-terminal domain superfamily; PurM-like, C-terminal domain; AIR synthase related protein, C-terminal domain; Class I glutamine amidotransferase-like; PurM-like, C-terminal domain superfamily; and CobB/CobQ-like glutamine amidotransferase domain. Is an ortholog of C. elegans pfas-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04547.1	CJA04547.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04547	CJA04547		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070480
• Remark: CJA04547, CGCGCCGTGGATTCGAATGTTTAGAAATGCGTTTGAGTGGTGCAAATCGGGGAAAAATTG, WBGene00123750
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term