WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123260 Gene Name  Cjp-hcf-1
Sequence Name  ? CJA04056 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Fibronectin type III; Immunoglobulin-like fold; Kelch motif; Host cell factor; Galactose oxidase, central domain; and Fibronectin type III superfamily. Is an ortholog of C. elegans hcf-1. In C. elegans, hcf-1 is involved in several processes, including dauer exit; determination of adult lifespan; and regulation of DNA-templated transcription. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04056.1 CJA04056.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04056 CJA04056   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-hcf-1, AAAAATTGTCGAGTACAGTGTCTATCTGGCTGTTAAAAATCAGTCGGCTACGGCGGCTGG, WBGene00123260   Expr1077546 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term