WormMine: Gene WBGene00123256

• WormBase Gene ID: WBGene00123256
• Gene Name: Cjp-pmt-2
• Sequence Name: CJA04052
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Methyltransferase domain 25; S-adenosyl-L-methionine-dependent methyltransferase; Phosphoethanolamine N-methyltransferase 2 N-terminal; Phosphoethanolamine N-methyltransferase 2, N-terminal; and Methyltransferase domain. Is an ortholog of C. elegans pmt-2. In C. elegans, pmt-2 is involved in phosphatidylcholine biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04052.1	CJA04052.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04052	CJA04052		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073024
• Remark: Cjp-pmt-2, CGGCGGTGGAGCACGACAGGTTGCAGATGAGTTTGGAGTTCATGTGCATGGAATCGACTT, WBGene00123256
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term