WormMine: Gene WBGene00123173

• WormBase Gene ID: WBGene00123173
• Gene Name: Cjp-ftt-2
• Sequence Name: CJA03969
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans ftt-2. In C. elegans, ftt-2 is involved in cytoplasmic sequestering of protein; dauer larval development; and negative regulation of protein import into nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03969.1	CJA03969.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03969	CJA03969		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086059
• Remark: Cjp-ftt-2, TCGAGAAGTCGCAGCAGAGCTACCAAGAGGCGTTCGACATCGCCAAGGATAAGATGCAGC, WBGene00123173
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term