WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122422 Gene Name  Cjp-eff-1
Sequence Name  ? CJA03218 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Cell-cell fusogen EFF/AFF, domain 3; Type I membrane glycoproteins cell-cell fusogen; and Cell-cell fusogen EFF/AFF. Is an ortholog of C. elegans eff-1. In C. elegans, eff-1 is involved in several processes, including anatomical structure morphogenesis; egg-laying behavior; and nematode pharyngeal muscle development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03218.1 CJA03218.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03218 CJA03218   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA03218, ATTCGAGACTTCTCTGGGTCAATTATTGTTGATTCAAAATCGAATCGACTGTTCAATTTG, WBGene00122422   Expr1087294 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term