WormMine: Gene WBGene00122399

• WormBase Gene ID: WBGene00122399
• Gene Name: CJA03195
• Sequence Name: CJA03195
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans hcp-1 and hcp-2. In C. elegans, hcp-1 is involved in several processes, including chromosome segregation; kinetochore assembly; and meiotic spindle organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03195.1	CJA03195.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03195	CJA03195		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079593
• Remark: CJA03195, AAAAGAGGAGGATCGCTTCGAAGACGCCTCTGACCTGTTTATGGGGAAACCGACACAGAA, WBGene00122399
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term