WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122291 Gene Name  Cjp-sea-2
Sequence Name  ? CJA03087 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans sea-2. In C. elegans, sea-2 is involved in several processes, including determination of adult lifespan; regulation of gene expression; and response to heat. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA03087b.1 CJA03087b.1   [unknown]
Transcript:CJA03087a.1 CJA03087a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA03087a CJA03087a   [unknown]
CDS:CJA03087b CJA03087b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-sea-2, CCCTGCGACAAAAACTTTTCCAGCGAGTGGAATCTTGATCGTCACAAGCGCGAAAATTGT, WBGene00122291   Expr1083325 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA04363, GCTTCAAGAGTTGCTCGTCGAGAATGAGCCGGAAGAGGATGGAGATAGTAGAAGTAGCTC, WBGene00123566   Expr1071468 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term