WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122103 Gene Name  Cjp-rle-1
Sequence Name  ? CJA02899 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Roquin II; Zinc finger, RING/FYVE/PHD-type; and Roquin II domain. Is an ortholog of C. elegans rle-1. In C. elegans, rle-1 is involved in determination of adult lifespan; response to heat; and ubiquitin-dependent protein catabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02899.1 CJA02899.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02899 CJA02899   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA11564, CTCAAACTCGTTGGACAAAATTGTGGATGTCAAGGAGCGGCTCAGCGAGGCACAAGGTAT, WBGene00130768   Expr1091893 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-rle-1, TCGTTACAGGAATTGGATGGAAGTAATGCTCAGCAGTCGTCTATGGTGATTATGCAGAGC, WBGene00122103   Expr1082195 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term