WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122102 Gene Name  Cjp-mboa-6
Sequence Name  ? CJA02898 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: MBOAT, membrane-bound O-acyltransferase family and Membrane bound O-acyl transferase, MBOAT. Is an ortholog of C. elegans mboa-6. In C. elegans, mboa-6 is involved in glycerophospholipid biosynthetic process; positive regulation of growth rate; and post-embryonic development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02898.1 CJA02898.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02898 CJA02898   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA06998, GTCACAATTTCCTATTCTATGAGTTTCGCATTCCTTATGTTCGGTCTCATTAAGACGAAA, WBGene00126202   Expr1090004 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-mboa-6, GCTTTCTTCAACTCGGATGCTTATTTTGTGAGTTTCGAAATCTGCAGCACTCTCCAATCT, WBGene00122102   Expr1080185 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term