WormMine: Gene WBGene00033205

• WormBase Gene ID: WBGene00033205
• Gene Name: Cbr-dao-5
• Sequence Name: CBG12223
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SRP40, C-terminal domain and Srp40, C-terminal. Is an ortholog of C. elegans dao-5. In C. elegans, dao-5 is involved in several processes, including determination of adult lifespan; insulin receptor signaling pathway; and nucleolar large rRNA transcription by RNA polymerase I.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12223.1	CBG12223.1		[unknown]
Transcript:CBG12223.2	CBG12223.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12223	CBG12223		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067985
• Remark: Cbr-dao-5, AGCTACGGCGGCGGTCCAATCAACCAATCTATCAATTCAATCAAGTTTTCGGATTCTGAC, WBGene00033205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term