WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121840 Gene Name  Cjp-cyb-3
Sequence Name  ? CJA02636 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Cyclin-like; Cyclin B3, G2/mitotic-specific; Cyclin; WD40/YVTN repeat-like-containing domain superfamily; Cyclin, C-terminal domain; Cyclin-like superfamily; Cyclin, N-terminal; Cyclin, N-terminal domain; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans cyb-3. In C. elegans, cyb-3 is involved in several processes, including chromosome organization; regulation of cell cycle; and sexual reproduction. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02636.1 CJA02636.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02636 CJA02636   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-cyb-3, ACGATGCACTACGTCAGCAACAAGTGGAATCAGCTGGTCTCTATCCGACAGAAATACAGC, WBGene00121840   Expr1078926 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA03957, GCAAAGTCCGAATGAATCACGTGTTGCTCTGCGACAATCTATCGATTCTGAACGACAATA, WBGene00123161   Expr1083002 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term