WormMine: Gene WBGene00125336

• WormBase Gene ID: WBGene00125336
• Gene Name: Cjp-let-70
• Sequence Name: CJA06132
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-conjugating enzyme; Ubiquitin-conjugating enzyme E2; and Ubiquitin-conjugating enzyme/RWD-like. Is an ortholog of C. elegans let-70. In C. elegans, let-70 is involved in programmed cell death involved in cell development; protein ubiquitination; and ubiquitin-dependent protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06132.1	CJA06132.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06132	CJA06132		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091498
• Remark: Cjp-let-70, GAACCCAGACGACCCGCTTGTGCCAGAGATCGCACGCATCTACAAAACGGATCGTGAAAG, WBGene00125336
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term