WormMine: Gene WBGene00125949

• WormBase Gene ID: WBGene00125949
• Gene Name: Cjp-swsn-1
• Sequence Name: CJA06745
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SMARCC, SWIRM-associated domain; SANT/Myb domain; SWI/SNF complex subunit SMARCC1; Myb-like DNA-binding domain; SWIRM-associated domain at the C-terminal; SWIRM-associated region 1; Winged helix-like DNA-binding domain superfamily; SWIRM domain; Homeobox-like domain superfamily; and SMARCC, C-terminal. Is an ortholog of C. elegans swsn-1. In C. elegans, swsn-1 is involved in several processes, including determination of adult lifespan; negative regulation of vulval development; and positive regulation of growth rate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06745.1	CJA06745.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06745	CJA06745		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073694
• Remark: Cjp-psa-1, CGTTCCATATGGATCAGCTCAAGTATCTTGAAAACCGAGCCAAGCACGAAGCGCATACCA, WBGene00125949
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term