WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125894 Gene Name  Cjp-atrn-1
Sequence Name  ? CJA06690 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Galactose-binding-like domain superfamily; Galactose oxidase/kelch, beta-propeller; EGF-like domain; CUB domain; Laminin EGF domain; Kelch motif; Kelch repeat type 1; PSI domain; Laminin-type EGF domain; Spermadhesin, CUB domain superfamily; Galactose oxidase, central domain; and Plexin repeat. Is an ortholog of C. elegans atrn-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06690.1 CJA06690.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06690 CJA06690   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA25715, TTGACGGTTTTCATTCTGATATTGACCACGTTCGAAGCAAACTCACTTACAAATTTTGCT, WBGene00181287   Expr1076766 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-tag-53, CTTGCCGTGGATTTCATTTTCACTTTCAAGTTAAAAAAGGATGAGAAAGACAACCACACG, WBGene00125894   Expr1082997 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term