WormMine: Gene WBGene00125267

• WormBase Gene ID: WBGene00125267
• Gene Name: Cjp-arx-1
• Sequence Name: CJA06063
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Actin; Actin-related protein 3; ATPase, nucleotide binding domain; and Actin family. Is an ortholog of C. elegans arx-1. In C. elegans, arx-1 is involved in Arp2/3 complex-mediated actin nucleation; embryonic morphogenesis; and epithelial cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06063b.1	CJA06063b.1		[unknown]
Transcript:CJA06063a.1	CJA06063a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06063a	CJA06063a		[unknown]
CDS:CJA06063b	CJA06063b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081423
• Remark: CJA06063, ATGTTCAAGTGATTTCCCACAAAATGCAAAGGTACGCTGTCTGGTTCGGAGGATCAATGT, WBGene00125267
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term