WormMine: Gene WBGene00133889

• WormBase Gene ID: WBGene00133889
• Gene Name: Cjp-dhs-21
• Sequence Name: CJA14685
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: NAD(P)-binding domain superfamily; Short-chain dehydrogenase/reductase SDR; and Enoyl-(Acyl carrier protein) reductase. Is an ortholog of C. elegans dhs-21. In C. elegans, dhs-21 is involved in xylulose catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14685.1	CJA14685.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14685	CJA14685		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071645
• Remark: Cjp-dhs-21, AGAGAAGAAGAAGAAAATGCTGGACCGAATGCCAATCAAGCGATTCGCCGAGGTGGACGA, WBGene00133889
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term