WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124940 Gene Name  Cjp-eel-1
Sequence Name  ? CJA05736 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: HUWE1/Rev1, ubiquitin binding region and Ubiquitin binding region. Is an ortholog of C. elegans eel-1. In C. elegans, eel-1 is involved in several processes, including asymmetric protein localization involved in cell fate determination; hemidesmosome assembly; and signal transduction in response to DNA damage. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05736b.1 CJA05736b.1   [unknown]
Transcript:CJA05736a.1 CJA05736a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05736b CJA05736b   [unknown]
CDS:CJA05736a CJA05736a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA27750, GAAGATGGTGAAGAAGAAGACAATGAAGATGATGACGATGATGACGATGCCGATGATGAT, WBGene00183323   Expr1091523 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term