WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00124391 Gene Name  Cjp-lron-7
Sequence Name  ? CJA05187 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: BspA type Leucine rich repeat region (6 copies); Leucine-rich repeat; Leucine-rich repeat, typical subtype; BspA type Leucine rich repeat region; Leucine rich repeat; Leucine-rich repeat domain superfamily; and Cysteine-rich flanking region, C-terminal. Is an ortholog of C. elegans lron-7. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA05187a.1 CJA05187a.1   [unknown]
Transcript:CJA05187c.1 CJA05187c.1   [unknown]
Transcript:CJA05187b.1 CJA05187b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA05187c CJA05187c   [unknown]
CDS:CJA05187b CJA05187b   [unknown]
CDS:CJA05187a CJA05187a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05187, TCAGTGGAAACCCATGGCAATGCGATTGTGATACTCAATTTTTGATGGAGGAGAAGTTTT, WBGene00124391   Expr1085145 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA19640, AACTACGCGACTTCAGGAGACAGCGAATTGTGTCATTGCGATATGGACGAAATTAATTGC, WBGene00175211   Expr1073504 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term