WormMine: Gene WBGene00124115

• WormBase Gene ID: WBGene00124115
• Gene Name: Cjp-drag-1
• Sequence Name: CJA04911
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Repulsive guidance molecule; Mog1/PsbP, alpha/beta/alpha sandwich; Repulsive guidance molecule, N-terminal; Repulsive guidance molecule, C-terminal; Repulsive guidance molecule (RGM) C-terminus; and Repulsive guidance molecule (RGM) N-terminus. Is an ortholog of C. elegans drag-1. In C. elegans, drag-1 is involved in several processes, including mesodermal cell fate specification; regulation of BMP signaling pathway; and regulation of dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04911.1	CJA04911.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04911	CJA04911		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081168
• Remark: Cja-drag-1, GTGTGTTTAGAAAGCCGGAAAAGTTTGTGGCGTGCTATGCAAGACAGCTACATGTGCCGA, WBGene00124115
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term