WormMine: Gene WBGene00124188

• WormBase Gene ID: WBGene00124188
• Gene Name: Cjp-ldb-1
• Sequence Name: CJA04984
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: LIM-domain binding protein/SEUSS; LIM interaction domain; LIM-domain binding protein; and LIM interaction domain (LID). Is an ortholog of C. elegans ldb-1. In C. elegans, ldb-1 is involved in several processes, including mechanosensory behavior; positive regulation of vulval development; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04984.1	CJA04984.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04984	CJA04984		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078133
• Remark: Cjp-ldb-1, GAACATGATGGGAGGACCTGCGATGTCAATGGCGAGTCAGATGCCTAGTTCAATGTCAAA, WBGene00124188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term