WormMine: Gene WBGene00124035

• WormBase Gene ID: WBGene00124035
• Gene Name: Cjp-npp-22
• Sequence Name: CJA04831
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Nucleoporin protein Ndc1-Nup. Is an ortholog of C. elegans npp-22.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04831c.1	CJA04831c.1		[unknown]
Transcript:CJA04831b.1	CJA04831b.1		[unknown]
Transcript:CJA04831a.1	CJA04831a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04831a	CJA04831a		[unknown]
CDS:CJA04831b	CJA04831b		[unknown]
CDS:CJA04831c	CJA04831c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080827
• Remark: Cjp-npp-22, CTTATGACTCTTCTATGTAAACTGATTGTCGCTCTAGACACTTACGAAAGAGCAAGAGCG, WBGene00124035
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term