WormMine: Gene WBGene00124779

• WormBase Gene ID: WBGene00124779
• Gene Name: Cjp-uri-1
• Sequence Name: CJA05575
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Prefoldin; Prefoldin alpha-like; and Prefoldin subunit. Is an ortholog of C. elegans uri-1. In C. elegans, uri-1 is involved in several processes, including germ-line stem cell division; intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05575.1	CJA05575.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05575	CJA05575		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091068
• Remark: Cjp-uri-1, GACGAGTAAGGATCCGGCGCCGGTGATCACCGAGCCAAAGATTTCAAAGTTTAGAGCGTC, WBGene00124779
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term