WormMine: Gene WBGene00124611

• WormBase Gene ID: WBGene00124611
• Gene Name: CJA05407
• Sequence Name: CJA05407
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Hypoxia induced protein conserved region and Hypoxia induced protein, domain. Is an ortholog of C. elegans T20D3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05407.1	CJA05407.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05407	CJA05407		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088735
• Remark: CJA05407, GAAAGGGACAGGCGAATTTTGTATCGTTAACTCCTCCGGTGGCCACTCCGAATTCACATT, WBGene00124611
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term