WormMine: Gene WBGene00060007

• WormBase Gene ID: WBGene00060007
• Gene Name: Cre-tin-13
• Sequence Name: CRE29754
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Mitochondrial import inner membrane translocase subunit Tim8/13; Tim10/DDP family zinc finger; Tim10-like domain superfamily; and Tim10-like. Is an ortholog of C. elegans tin-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29754.1	CRE29754.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29754	CRE29754		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104526
• Remark: Cre-tin-13, CAAAAGCGTCTTCAGGAAGAAATGGCATCATCAGGTGGAATGGGCGGTGGATTCGGTCAA, WBGene00060007
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term