WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061739 Gene Name  Cre-pfas-1.1
Sequence Name  ? CRE20243 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Phosphoribosylformylglycinamidine synthase, linker domain; Formylglycinamide ribonucleotide amidotransferase linker domain; PurM-like, N-terminal domain superfamily; Phosphoribosylformylglycinamidine synthase, N-terminal; PurM-like, C-terminal domain; Formylglycinamide ribonucleotide amidotransferase N-terminal; Phosphoribosylformylglycinamidine synthase subunit PurS-like superfamily; PurM-like, C-terminal domain superfamily; and AIR synthase related protein, C-terminal domain. Is an ortholog of C. elegans pfas-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20243.1 CRE20243.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20243 CRE20243   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE20243, TGGTCGAAGGATGTGGAGTAACAGTAGACAGTAATTCATTCCAACTTGGGGACGAAAGCA, WBGene00061739   Expr1102651 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term