WormMine: Gene WBGene00127326

• WormBase Gene ID: WBGene00127326
• Gene Name: CJA08122
• Sequence Name: CJA08122
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: GyrI-like small molecule binding domain and Regulatory factor, effector binding domain superfamily. Is an ortholog of C. elegans T24H7.9. In C. elegans, T24H7.9 is involved in sterol metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08122.1	CJA08122.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08122	CJA08122		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090868
• Remark: CJA08122, TCACCTACTCGAACATTAGAAAGTTTATCGCTGATAACAGATTGGAGGTGAAGTACGCTG, WBGene00127326
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term