WormMine: Gene WBGene00061743

• WormBase Gene ID: WBGene00061743
• Gene Name: Cre-sel-2
• Sequence Name: CRE20245
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-type fold; Neurobeachin-like, DUF1088; Neurobeachin/BDCP, DUF4704 alpha solenoid region; Concanavalin A-like lectin/glucanases superfamily; Neurobeachin/BDCP, DUF4704; and Concanavalin A-like lectin/glucanase domain superfamily. Is an ortholog of C. elegans sel-2. In C. elegans, sel-2 is involved in several processes, including apical protein localization; negative regulation of Notch signaling pathway; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20245.1	CRE20245.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20245	CRE20245		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103213
• Remark: Cre-sel-2, AACCTGTGCTCCACTTCTAAGAGAAATGATGTCGGATTTCCGTGGTTACCTTCAAAAAAC, WBGene00061743
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term