WormMine: Gene WBGene00127158

• WormBase Gene ID: WBGene00127158
• Gene Name: Cjp-slx-1
• Sequence Name: CJA07954
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; GIY-YIG endonuclease; GIY-YIG endonuclease superfamily; and GIY-YIG catalytic domain. Is an ortholog of C. elegans slx-1. In C. elegans, slx-1 is involved in several processes, including DNA metabolic process; meiotic chromosome separation; and regulation of multicellular organismal development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07954b.1	CJA07954b.1		[unknown]
Transcript:CJA07954a.1	CJA07954a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07954a	CJA07954a		[unknown]
CDS:CJA07954b	CJA07954b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084744
• Remark: Cja-slx-1, GCTCCGATTCGAATGGGCTTGGCAGAATCCGAATGTGTCGAAATGCATCAAAGAGCTGCA, WBGene00127158
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term