WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127867 Gene Name  Cjp-lhfp-4
Sequence Name  ? CJA08663 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Lectin C-type domain; Lipoma HMGIC fusion partner-like protein; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans lhfp-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08663d.1 CJA08663d.1   [unknown]
Transcript:CJA08663c.1 CJA08663c.1   [unknown]
Transcript:CJA08663b.1 CJA08663b.1   [unknown]
Transcript:CJA08663a.1 CJA08663a.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08663d CJA08663d   [unknown]
CDS:CJA08663c CJA08663c   [unknown]
CDS:CJA08663b CJA08663b   [unknown]
CDS:CJA08663a CJA08663a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-clec-196, CAACCCGCCACTACAACTACTACTATTCTTGCTTGTCAAAGTTTCACGTGGTTTGTGAAC, WBGene00119897   Expr1086657 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA08663, AACACAATTCAACCGGTGCCACGACCGCGAAAAATGTCGCTTCAAGACTCGTTTTACTCA, WBGene00127867   Expr1076456 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term