WormMine: Gene WBGene00127628

• WormBase Gene ID: WBGene00127628
• Gene Name: CJA08425
• Sequence Name: CJA08425
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: HORMA domain superfamily and Mitotic spindle checkpoint protein Mad2. Is an ortholog of C. elegans mdf-2. In C. elegans, mdf-2 is involved in embryo development; mitotic spindle assembly checkpoint signaling; and response to anoxia.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08425a.1	CJA08425a.1		[unknown]
Transcript:CJA08425b.1	CJA08425b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08425a	CJA08425a		[unknown]
CDS:CJA08425b	CJA08425b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077380
• Remark: Cjp-mdf-2, TCATTCTCCACGGCGGTCCACGGAGTTAACACTAATGTTCAGTACAAGGCTGATTTTTAA, WBGene00127628
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term