WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00127621 Gene Name  Cjp-cox-14
Sequence Name  ? CJA08417 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Cytochrome oxidase c assembly and Cytochrome c oxidase assembly protein COX14. Is an ortholog of C. elegans cox-14. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08417.2 CJA08417.2   [unknown]
Transcript:CJA08417.1 CJA08417.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08417 CJA08417   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA08417, AACGAGAAATTCTGGAAAGGGAGCTTATTGAAGCCGATAGAGCTGGATTTGCCCTGAAGA, WBGene00127621   Expr1088533 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term