WormMine: Gene WBGene00126703

• WormBase Gene ID: WBGene00126703
• Gene Name: CJA07499
• Sequence Name: CJA07499
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Nuclear hormone receptor-like domain superfamily; Ligand-binding domain of nuclear hormone receptor; and Nuclear hormone receptor, ligand-binding domain. Is an ortholog of C. elegans Y67D8B.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07499a.1	CJA07499a.1		[unknown]
Transcript:CJA07499b.1	CJA07499b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07499a	CJA07499a		[unknown]
CDS:CJA07499b	CJA07499b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087895
• Remark: CJA07499, TGGTGGAGAACAACTATGGCGGCATGCGTGGCATTCTTCAGCAACAAATTCACACGGAAT, WBGene00126703
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term