WormMine: Gene WBGene00061772

• WormBase Gene ID: WBGene00061772
• Gene Name: Cre-ifet-1
• Sequence Name: CRE20258
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domain: Eukaryotic translation initiation factor 4E binding protein. Is an ortholog of C. elegans ifet-1. In C. elegans, ifet-1 is involved in negative regulation of translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20258.2	CRE20258.2		[unknown]
Transcript:CRE20258.1	CRE20258.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20258	CRE20258		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109102
• Remark: Cre-pqn-45, AGACCGTATCCCAACATCAGCTCGCCCAATGTCTCTTGAAGATCTTGAAAAGCAGTTAAC, WBGene00061772
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term