WormMine: Gene WBGene00126376

• WormBase Gene ID: WBGene00126376
• Gene Name: CJA07172
• Sequence Name: CJA07172
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class j (Srj) and Serpentine type 7TM GPCR chemoreceptor Srj. Is an ortholog of C. elegans srj-57; srj-55; and srj-54.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07172a.1	CJA07172a.1		[unknown]
Transcript:CJA07172c.1	CJA07172c.1		[unknown]
Transcript:CJA07172b.1	CJA07172b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07172b	CJA07172b		[unknown]
CDS:CJA07172a	CJA07172a		[unknown]
CDS:CJA07172c	CJA07172c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088466
• Remark: CJA07172, CGTTTATCGAAGAGTTAAGACAAGGGATCAGATACCGTGTGTCATTTATGTGTCTCAGAA, WBGene00126376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term