WormMine: Gene WBGene00062430

• WormBase Gene ID: WBGene00062430
• Gene Name: Cre-ced-12
• Sequence Name: CRE23961
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-like helical; Pleckstrin homology domain; Armadillo-type fold; ELMO, armadillo-like helical domain; and PH-like domain superfamily. Is an ortholog of C. elegans ced-12. In C. elegans, ced-12 is involved in several processes, including cytoskeleton organization; engulfment of apoptotic cell; and left/right axis specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE23961.1	CRE23961.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE23961	CRE23961		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1094876
• Remark: Cre-ced-12, CAATGTGAAGCTGTCGAATCCAGAAGAGAAGCCAGAGATTCCTCCGATTCCAGAAGATTT, WBGene00062430
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term