WormMine: Gene WBGene00062492

• WormBase Gene ID: WBGene00062492
• Gene Name: Cre-lgg-2
• Sequence Name: CRE12747
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Autophagy protein Atg8 ubiquitin-like; and Autophagy protein Atg8 ubiquitin like. Is an ortholog of C. elegans lgg-2. In C. elegans, lgg-2 is involved in cellular response to toxic substance; defense response to other organism; and positive regulation of autophagosome maturation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12747.1	CRE12747.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12747	CRE12747		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097852
• Remark: Cre-lgg-2, CAACTCAATGAGCATGTCCAACTTGTACAGTCAAGAACGTGATCCAGATGGCTTCGTTTA, WBGene00062492
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term