WormMine: Gene WBGene00062356

• WormBase Gene ID: WBGene00062356
• Gene Name: CRE24008
• Sequence Name: CRE24008
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin subtype 2; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans unc-89. In C. elegans, unc-89 is involved in several processes, including myofibril assembly; nematode pharyngeal gland morphogenesis; and regulation of striated muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24008.1	CRE24008.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24008	CRE24008		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098296
• Remark: CRE24008, AGTGTTGTCGTCGACGAGAATGACTCGAAAAAGTCCACTTCAGAAGTCCAAAAGTCTTCT, WBGene00062356
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term