WormMine: Gene WBGene00062286

• WormBase Gene ID: WBGene00062286
• Gene Name: CRE22576
• Sequence Name: CRE22576
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: BTB And C-terminal Kelch; SKP1/BTB/POZ domain superfamily; BTB/Kelch-associated; and BTB/POZ domain. Is an ortholog of C. elegans W07A12.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE22576.1	CRE22576.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE22576	CRE22576		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109207
• Remark: CRE22576, AGGCAATGGATCAGCCTCGATCGATTGAATATCTTCTCCAAATAGTCGACGATAAGAAGG, WBGene00062286
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term