WormMine: Gene WBGene00062238

• WormBase Gene ID: WBGene00062238
• Gene Name: Cre-nurf-1
• Sequence Name: CRE24964
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; DDT domain; Zinc finger, FYVE/PHD-type; and Zinc finger, PHD-type. Is an ortholog of C. elegans nurf-1. In C. elegans, nurf-1 is involved in positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24964a.1	CRE24964a.1		[unknown]
Transcript:CRE24964b.1	CRE24964b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24964a	CRE24964a		[unknown]
CDS:CRE24964b	CRE24964b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114006
• Remark: Cre-nurf-1, CTCTATTCATCACCAAATGCTATTCGTCATCGTGTCGTCGGATTCCCAACGTTCCCAACC, WBGene00062238
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term