WormMine: Gene WBGene00062729

• WormBase Gene ID: WBGene00062729
• Gene Name: Cre-exos-4.1
• Sequence Name: CRE10298
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Tim10-like; 3' exoribonuclease family, domain 1; Exoribonuclease, phosphorolytic domain 1; PNPase/RNase PH domain superfamily; Exoribonuclease, PH domain 2 superfamily; Ribosomal protein S5 domain 2-type fold; Tim10/DDP family zinc finger; and Tim10-like domain superfamily. Is an ortholog of C. elegans exos-4.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10298.1	CRE10298.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10298	CRE10298		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108797
• Remark: Cre-tin-9.2, GCAACTTGCGCCGATGTATATGAATGCCTCGCTGTAGTCGCTCAACAACATCTCAAAGCT, WBGene00062729
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term