WormMine: Gene WBGene00062589

• WormBase Gene ID: WBGene00062589
• Gene Name: Cre-magi-1
• Sequence Name: CRE12791
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; PDZ domain; WW domain; WW domain superfamily; Guanylate kinase/L-type calcium channel beta subunit; Guanylate kinase; and PDZ superfamily. Is an ortholog of C. elegans magi-1. In C. elegans, magi-1 is involved in habituation; long-term memory; and regulation of protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12791.1	CRE12791.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12791	CRE12791		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113750
• Remark: Cre-magi-1, AAAGGTTTCGGATTCTCAATTCGTGGAGGGCAAGAGTTTGGATCAATGCCACTGTTTGTT, WBGene00062589
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term