WormMine: Gene WBGene00062053

• WormBase Gene ID: WBGene00062053
• Gene Name: Cre-smk-1
• Sequence Name: CRE18762
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-type fold; PH-like domain superfamily; Domain of unknown function DUF625; and Phosphatase 4 regulatory subunit 3. Is an ortholog of C. elegans smk-1. In C. elegans, smk-1 is involved in negative regulation of mitotic DNA damage checkpoint; response to radiation; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18762.1	CRE18762.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18762	CRE18762		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112696
• Remark: Cre-smk-1, TCAGTCGCAAACGAACCAGTGATGGCTGCGACCCCAATGATCCAAAGAGAAGTAGAACAG, WBGene00062053
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term