WormMine: Gene WBGene00062005

• WormBase Gene ID: WBGene00062005
• Gene Name: Cre-dpy-1
• Sequence Name: CRE02342
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: von Willebrand factor, type A; Zona pellucida domain; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans dpy-1. In C. elegans, dpy-1 is involved in body morphogenesis and regulation of growth.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02342.1	CRE02342.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02342	CRE02342		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107312
• Remark: CRE02342, CGTCACCGACACCCAACCCAAGACTAGCAGATTTTATGCGAAATTTCGATAGAAATCGAT, WBGene00062005
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term