WormMine: Gene WBGene00136677

• WormBase Gene ID: WBGene00136677
• Gene Name: Cjp-samp-1
• Sequence Name: CJA17473
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ima1, N-terminal domain; Ima1 N-terminal domain; and Transmembrane protein 201. Is an ortholog of C. elegans samp-1. In C. elegans, samp-1 is involved in embryo development and nuclear migration along microtubule.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17473.1	CJA17473.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17473	CJA17473		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071478
• Remark: CJA17473, TGAAAAAAGTGATTGGATCCACTCTCCACGAAGCGATGAACCCGTACAAACGAAGCGCGC, WBGene00136677
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term