WormMine: Gene WBGene00129847

• WormBase Gene ID: WBGene00129847
• Gene Name: Cjp-ham-2
• Sequence Name: CJA10643
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans ham-2. In C. elegans, ham-2 is involved in cell fate determination; cell migration; and regulation of neuron differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10643.1	CJA10643.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10643	CJA10643		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084313
• Remark: Cjp-ham-2, CGCCAACTTTCTTCAAAATCCTGCCATGCGCCTTCTCCTAAACAATCTCGTTCATATGAA, WBGene00129847
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term