WormMine: Gene WBGene00129276

• WormBase Gene ID: WBGene00129276
• Gene Name: CJA10072
• Sequence Name: CJA10072
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF870, Caenorhabditis species and Caenorhabditis elegans protein of unknown function (DUF870). Is an ortholog of C. elegans Y59H11AR.3; T26A8.3; and F47C12.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10072.1	CJA10072.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10072	CJA10072		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088093
• Remark: CJA10072, TGAATTGAAGTTGAAAGCGCGGCACAATTGTTCAACACACGGAGAGCTACTTGATGTGTG, WBGene00129276
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term