WormMine: Gene WBGene00061803

• WormBase Gene ID: WBGene00061803
• Gene Name: Cre-dcn-1
• Sequence Name: CRE20383
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Potentiating neddylation domain; UBA-like domain; Defective-in-cullin neddylation protein; Cullin binding; and UBA-like superfamily. Is an ortholog of C. elegans dcn-1. In C. elegans, dcn-1 is involved in microtubule cytoskeleton organization; protein catabolic process; and protein neddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20383.1	CRE20383.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20383	CRE20383		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114742
• Remark: Cre-dcn-1, CAGTTTGTAGATCACTGTCGTTCTTCATTGAATTATCCAACTCCACAGCCAGCTGGACAA, WBGene00061803
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term